If you have any problems in viewing this Newsletter, please click here
 
 October 2018
 
END OF YEAR PROMOTION
 
  

30% discount off the list price value of BioLegend's catalogue range of products

25% maximum discount for GoInVivo™, Brilliant Violet™, Flash Phalloidin™, ATPase, Rainbow Particles, DAPI, CFSE, TetraZ™ and MojoSort™ products

Promo-Code: SM-011018    >>>  Choose and Order HERE

Offer is valid until 31st December 2018. Not summable with other discounts.

 
 
 
New Cell Hashtag Reagents for Single Cell Analysis

To complement the collection of TotalSeq™ antibodies, BioLegend now offer antibody-oligonucleotide conjugates to allow for sample multiplexing and robust multiplet discrimination during single cell analysis. These cell Hashtag reagents are a pool of antibodies conjugated to a unique barcode sequence and are designed to cover as many cells as possible in both human and mouse samples:

Hashtag reagents for human samples are comprised of antibodies detecting CD298 and β2 microglobulin. Hashtag reagents for mouse samples, contain antibodies against CD45 and H-2 MHC class I.

Because the Hashtag antibodies use a different amplification handle than our TotalSeq™ reagents Hashtags, immunophenotyping, and mRNA libraries can be independently amplified and pooled at desired ratios for sequencing.
 
The conjugates are already pre-mixed and ready to use.
The full sequence of the oligonucleotide includes a PCR handle (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT), the 15 bp barcode, and a poly A tail (BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A). The hashtag's name includes a sequential numeral identifier (different from the barcode number) for convenience when designing multiplex experiments.
 
Human
 
Mouse
Product
Cat.No.
Product
Cat.No.
394601
394601
394603
394603
394605
394605
394607
394607
394609
394609
394611
394611
394613
394613
394615
394615
394617
394617
394619
394619
394623
394623
394625
394625
394627
394627
394629
 
 
Email: lucerna-chem@lucerna-chem.ch Phone: +41 41 420 96 36 Fax: +41 41 420 96 56 Web: www.lucerna-chem.ch
 Lucerna-Chem,  AG Abendweg 18,  CH-6006 Luzern

Lucerna-Chem respects the web and the privacy of those who use it. We do not rent or sell our mailing list to anyone.
This e-Mail is Virus checked!

If you'd rather not receive Emails about product updates or Newsletters, click HERE.